 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| CCDC66 | |||
| Gene | Organism | Human | |
| Genome Locus | Build | hg19 | |
| Disease | Lung Adenocarcinoma | ICD-10 | Malignant neoplasm of bronchus and lung (C34) |
| DBLink | PMID | 29855336 | |
| Experimental Method | |||
| Sample Type | Tissue and cell lines | Comparison | tissue specimens were collected from 628 patients with newly diagnosed non-small cell lung cancer cell (NSCLC) |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward TGAATTTCTTCTATCAACAG ReverseCCTGGCTTCATCTATTCCAT | Statistics | Fold Change : Upregulated pvalue : <0.05 |
| Citation | |||
| Joseph, NA, Chiou, SH, Lung, Z, Yang, CL, Lin, TY, Chang, HW, Sun, HS, Gupta, SK, Yen, L, Wang, SD, Chow, KC (2018). The role of HGF-MET pathway and CCDC66 cirRNA expression in EGFR resistance and epithelial-to-mesenchymal transition of lung adenocarcinoma cells. J Hematol Oncol, 11, 1:74. | |||